make -Wall -Wextra -std 11 -O3 -o multy первый запук multy -i TEST2 fa

 1
 2
 3
 4
 5
 6
 7
 8
 9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
58
59
60
61
62
63
64
65
66
67
68
69
70
71
72
73
74
75
76
77
78
79
80
$ make
g++ -Wall -Wextra -std=c++11 -O3 *.c++ -o multy
#первый запук
$ ./multy -i TEST2.fas
Reading sequences...
6 sequences were obtained
Input parameters:
NT substitution matrix NUC-45
AA substitution matrix BLOSUM62
Gap open cost -10
Gap extension cost -3
Gap frame cost -15
Stop codon cost -50
>Gorilla
ATGGGCTGTGTGCAATGTAAGGATAAAGAAGCAACAAAACTGACGGAGGAGAGGGACGGC-AGCCTGAACCAGAGCTCTGGGTA
>Otolemur
ATGGGCTGTGTGCAATGTAAGGATAAAGAAGCAACAAAACTGACGGAGGAGCGGGACGGC-AGCCTGAACCAGAGCTCCGGGTA
>Equus
ATGGGCTGTGTGCAATGTAAGGATAAAGAAGCAACAAAACTGACAGAGGAGAGGGACGGC-AGCCTGAACCAGAGCTCCGGGTA
>GorillZ
ATGGGCTGTGTGCAATGTAAGGATAAAGAAGCAACAAAACTGACGGAGGAGAGGGACGGC-AGCCTGAACCAGAGCTCTGGGTA
>Otolemur
ATGGGCTGTGTGCAATGTAAGGATAAAGAAGCAACAAAACTGACGGAGGAGCGGGACGGC-AGCCTGAACCAGAGCTCCGGGTA
>Equus
ATGGGCTGTGTGCAATGTAAGGATAAAGAAGCAACAAAACTGACAGAGGAGAGGGACGGC-AGCCTGAACCAGAGCTCCGGGTA
>Gorilla
MGCVQCKDKEATKLTEERDG!PEPELWV
>Otolemur
MGCVQCKDKEATKLTEERDG!PEPELRV
>Equus
MGCVQCKDKEATKLTEERDG!PEPELRV
>GorillZ
MGCVQCKDKEATKLTEERDG!PEPELWV
>Otolemur
MGCVQCKDKEATKLTEERDG!PEPELRV
>Equus
MGCVQCKDKEATKLTEERDG!PEPELRV
#второй запуск, больше бонус за неразрывность рамки
$ ./multy -i TEST2.fas -b 10
Reading sequences...
6 sequences were obtained
Input parameters:
NT substitution matrix NUC-45
AA substitution matrix BLOSUM62
Gap open cost -10
Gap extension cost -3
Gap frame cost -15
Stop codon cost -50
>Gorilla
ATGGGCTGTGTGCAATGTAAGGATAAAGAAGCAACAAAACTGACGGAGGAGAGGGACGGCAGCCTGAACCAGAGCTCTGGGTA-
>Otolemur
ATGGGCTGTGTGCAATGTAAGGATAAAGAAGCAACAAAACTGACGGAGGAGCGGGACGGCAGCCTGAACCAGAGCTCCGGGTA-
>Equus
ATGGGCTGTGTGCAATGTAAGGATAAAGAAGCAACAAAACTGACAGAGGAGAGGGACGGCAGCCTGAACCAGAGCTCCGGGTA-
>GorillZ
ATGGGCTGTGTGCAATGTAAGGATAAAGAAGCAACAAAACTGACGGAGGAGAGGGACGGCAGCCTGAACCAGAGCTCTGGGTA-
>Otolemur
ATGGGCTGTGTGCAATGTAAGGATAAAGAAGCAACAAAACTGACGGAGGAGCGGGACGGCAGCCTGAACCAGAGCTCCGGGTA-
>Equus
ATGGGCTGTGTGCAATGTAAGGATAAAGAAGCAACAAAACTGACAGAGGAGAGGGACGGCAGCCTGAACCAGAGCTCCGGGTA-
>Gorilla
MGCVQCKDKEATKLTEERDGSLNQSSG!
>Otolemur
MGCVQCKDKEATKLTEERDGSLNQSSG!
>Equus
MGCVQCKDKEATKLTEERDGSLNQSSG!
>GorillZ
MGCVQCKDKEATKLTEERDGSLNQSSG!
>Otolemur
MGCVQCKDKEATKLTEERDGSLNQSSG!
>Equus
MGCVQCKDKEATKLTEERDGSLNQSSG!