multy TEST2 fas Reading sequences sequences were obtained Input parame

 1
 2
 3
 4
 5
 6
 7
 8
 9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
58
59
60
61
62
63
64
65
66
67
68
69
70
71
72
$ ./multy TEST2.fas
Reading sequences...
6 sequences were obtained
Input parameters:
NT substitution matrix NUC-45
AA substitution matrix BLOSUM62
Gap open cost -5
Gap extension cost -3
Gap frame cost -8
Stop codon cost -5
ATGGGCTGTGTGCAATGTAAGGATAAAGAAGCAACAAAACTGACGGAGGAGAGGGACGGCAGCCTGAACCAGAGCTCTGGG-TA >Gorilla
ATGGGCTGTGTGCAATGTAAGGATAAAGAAGCAACAAAACTGACGGAGGAGCGGGACGGCAGCCTGAACCAGAGCTCCGGG-TA >Otolemur
ATGGGCTGTGTGCAATGTAAGGATAAAGAAGCAACAAAACTGACAGAGGAGAGGGACGGCAGCCTGAACCAGAGCTCCGGG-TA >Equus
ATGGGCTGTGTGCAATGTAAGGATAAAGAAGCAACAAAACTGACGGAGGAGAGGGACGGCAGCCTGAACCAGAGCTCTGGG-TA >GorillZ
ATGGGCTGTGTGCAATGTAAGGATAAAGAAGCAACAAAACTGACGGAGGAGCGGGACGGCAGCCTGAACCAGAGCTCCGGG-TA >Otolemur
ATGGGCTGTGTGCAATGTAAGGATAAAGAAGCAACAAAACTGACAGAGGAGAGGGACGGCAGCCTGAACCAGAGCTCCGGG-TA >Equus
MGCVQCKDKEATKLTEERDGSLNQSSG! >Gorilla
MGCVQCKDKEATKLTEERDGSLNQSSG! >Otolemur
MGCVQCKDKEATKLTEERDGSLNQSSG! >Equus
MGCVQCKDKEATKLTEERDGSLNQSSG! >GorillZ
MGCVQCKDKEATKLTEERDGSLNQSSG! >Otolemur
MGCVQCKDKEATKLTEERDGSLNQSSG! >Equus
$ java -jar macse_v1.01b.jar -prog alignSequences -seq TEST2.fas
Gorilla The_Standard_Code
Otolemur The_Standard_Code
Equus The_Standard_Code
GorillZ The_Standard_Code
Otolemur The_Standard_Code
Equus The_Standard_Code
Build draft alignment using greedy strategy based on UPGMA tree
compute kmer dist
build UPGMA done
+++++start refining the alignment
(((((seq_1,seq_4),seq_6),seq_3),seq_5),seq_2)
.........-
(seq_2)
.
Refine 2 cut : sum of pair========= 1 => -2101.5
total time: 223.0
false
TEST2_macse_NT.fasta
$ cat TEST2_macse_NT.fasta
>Gorilla
ATGGGCTGTGTGCAATGTAAGGATAAAGAA---GCAACAAAACTGACGGAGGAGAGGGACGGCAGCCTGAACCAGAGCTCTGGG!TA
>GorillZ
ATGGGCTGTGTGCAATGTAAGGATAAAGAA---GCAACAAAACTGACGGAGGAGAGGGACGGCAGCCTGAACCAGAGCTCTGGG!TA
>Otolemur
ATGGGCTGTGTGCAATGTAAGGATAAAGAA---GCAACAAAACTGACGGAGGAGCGGGACGGCAGCCTGAACCAGAGCTCCGGG!TA
>Otolemur
ATGGGCTGTGTGCAATGTAAGGATAAAGAA---GCAACAAAACTGACGGAGGAGCGGGACGGCAGCCTGAACCAGAGCTCCGGG!TA
>Equus
ATGGGCTGTGTGCAATGTAAGGATAAAGAA---GCAACAAAACTGACAGAGGAGAGGGACGGCAGCCTGAACCAGAGCTCCGGG!TA
>Equus
ATGGGCTGTGTGCAATGTAAGGATAAAGAA---GCAACAAAACTGACAGAGGAGAGGGACGGCAGCCTGAACCAGAGCTCCGGG!TA
$ cat TEST2_macse_AA.fasta
>Gorilla
MGCVQCKDKE-ATKLTEERDGSLNQSSG!
>GorillZ
MGCVQCKDKE-ATKLTEERDGSLNQSSG!
>Otolemur
MGCVQCKDKE-ATKLTEERDGSLNQSSG!
>Otolemur
MGCVQCKDKE-ATKLTEERDGSLNQSSG!
>Equus
MGCVQCKDKE-ATKLTEERDGSLNQSSG!
>Equus
MGCVQCKDKE-ATKLTEERDGSLNQSSG!